Successful Transition from Plasma Exchange to Eculizumab in Acetylcholine Receptor Antibody- and Muscle-Specific Kinase (MuSK) Antibody-Negative Myasthenia Gravis: A Case Report.

BACKGROUND The effectiveness of eculizumab (terminal complement inhibitor) at the acetylcholine receptor (AChR) antibody-negative general myasthenia gravis (GMG) is unknown. CASE REPORT A female patient was diagnosed with AChR-antibody and muscle-specific kinase (musk) antibody-negative GMG in March 2016. In January 2017, the patient was referred for plasma exchange (PLEX) because the symptoms continue.

He also received azathioprine, mycophenolate mofetil, and pyridostigmine (all continued during subsequent therapy). PLEX (5 sessions for 10 days) was initially effective, but over the next month PLEX patients received weekly, then twice a week, followed by 3 times a week for symptoms to worsen. In April 2018, PLEX reduced to two times a week following initiation of eculizumab (weekly induction dose of 900 mg 1 day after the first PLEX, plus 600 mg on day PLEX second session, for 4 weeks).

Patients then stabilized eculizumab 1200 mg every 2 weeks and PLEX treatment frequency reduced, until PLEX stopped on Sunday 39 after initiation of eculizumab. During eculizumab treatment, myasthenia gravis patients with activities of daily living (MG-ADL) scores decreased 9-1 or second most votes, with a temporary increase to 4 or 5 between Weeks 19 and 27 after eculizumab treatment less often. No side effects related to eculizumab.

CONCLUSION After the transition from three times a week PLEX for eculizumab in patients with treatment-refractory, AChR antibodies and antibody-negative musk GMG, there is clinically significant improvement in daily activities are affected by the symptoms of MG. Further investigation of eculizumab in antibody-negative MG necessary.

Human Tubulin Beta 3 (TUBb3) ELISA Kit

DL-TUBb3-Hu-192 1 kit of 192 tests
EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 3 (TUBb3)

Human Tubulin Beta 3 (TUBb3) ELISA Kit

DL-TUBb3-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 3 (TUBb3)

Human Tubulin Beta 3 (TUBb3) ELISA Kit

DL-TUBb3-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 3 (TUBb3)

Human Tubulin Beta 3 (TUBb3) ELISA Kit

RD-TUBb3-Hu-48Tests 48 Tests
EUR 521.00

Human Tubulin Beta 3 (TUBb3) ELISA Kit

RD-TUBb3-Hu-96Tests 96 Tests
EUR 723.00

Human Tubulin Beta 3 (TUBb3) ELISA Kit

RDR-TUBb3-Hu-48Tests 48 Tests
EUR 544.00

Human Tubulin Beta 3 (TUBb3) ELISA Kit

RDR-TUBb3-Hu-96Tests 96 Tests
EUR 756.00

Tubb3/ Rat Tubb3 ELISA Kit

ELI-05371r 96 Tests
EUR 657.00

TUBB3 siRNA

20-abx905870
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TUBB3 antibody

10R-10559 100 ug
EUR 349.00
Description: Mouse monoclonal TUBB3 antibody

TUBB3 antibody

10R-8390 100 ul
EUR 392.00
Description: Mouse monoclonal TUBB3 antibody

TUBB3 antibody

10R-1824 100 ul
EUR 403.00
Description: Mouse monoclonal TUBB3 antibody

TUBB3 antibody

10R-6182 100 ul
EUR 726.00
Description: Mouse monoclonal TUBB3 antibody

TUBB3 Antibody

CSB-PA884597-
EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

TUBB3 Antibody

CSB-PA884597-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

TUBB3 Antibody

1-CSB-PA917452
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:1000, IHC:1:25-1:50

TUBB3 Antibody

CSB-PA969690-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

TUBB3 Antibody

CSB-PA969690-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

TUBB3 Antibody

1-CSB-PA000385
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:2000-5000

TUBB3 Antibody

1-CSB-PA000393
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:2000-5000

TUBB3 siRNA

20-abx938564
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TUBB3 siRNA

20-abx938565
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TUBB3 Antibody

35539-100ul 100ul
EUR 252.00

TUBB3 antibody

70R-21061 50 ul
EUR 435.00
Description: Rabbit polyclonal TUBB3 antibody

TUBB3 antibody

70R-15421 100 ug
EUR 327.00
Description: Rabbit polyclonal TUBB3 antibody

TUBB3 Antibody

1-CSB-PA004349
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

TUBB3 Antibody

1-CSB-PA025323GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TUBB3 Antibody

1-CSB-PA03874A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

TUBB3 Antibody

1-CSB-PA03879A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

pOTB7-TUBB3

PVT18504 2 ug
EUR 231.00

TUBB3 Antibody

AF7000 200ul
EUR 304.00
Description: TUBB3 Antibody detects endogenous levels of total TUBB3.

TUBB3 Antibody

BF0572 200ul
EUR 376.00
Description: TUBB3 antibody detects endogenous levels of total TUBB3.

TUBB3 Polyclonal Antibody

A53965 100 µg
EUR 570.55
Description: Ask the seller for details

TUBB3 Polyclonal Antibody

A51998 100 µg
EUR 570.55
Description: kits suitable for this type of research

TUBB3 cloning plasmid

CSB-CL623813HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1353
  • Sequence: atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttctgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcggacttgcagctggagcggatcagcgtctactacaacgaggcctcttctcacaagt
  • Show more
Description: A cloning plasmid for the TUBB3 gene.

TUBB3 Conjugated Antibody

C35539 100ul
EUR 397.00

TUBB3 Monoclonal Antibody

30323-100ul 100ul
EUR 252.00

TUBB3 Monoclonal Antibody

30323-50ul 50ul
EUR 187.00

TUBB3 antibody (HRP)

60R-2074 100 ug
EUR 327.00
Description: Rabbit polyclonal TUBB3 antibody (HRP)

TUBB3 antibody (FITC)

60R-2075 100 ug
EUR 327.00
Description: Rabbit polyclonal TUBB3 antibody (FITC)

TUBB3 antibody (biotin)

60R-2076 100 ug
EUR 327.00
Description: Rabbit polyclonal TUBB3 antibody (biotin)

anti-TUBB3 (2E9)

LF-MA30351 100 ul
EUR 486.00
Description: Mouse Monoclonal to TUBB3

TUBB3 Blocking Peptide

BF0572-BP 1mg
EUR 195.00

TUBB3 Blocking Peptide

AF7000-BP 1mg
EUR 195.00

TUBB3 specific antibody

PAab09890 100 ug
EUR 386.00

TUBB3 Rabbit pAb

A17073-100ul 100 ul
EUR 308.00

TUBB3 Rabbit pAb

A17073-200ul 200 ul
EUR 459.00

TUBB3 Rabbit pAb

A17073-20ul 20 ul
EUR 183.00

TUBB3 Rabbit pAb

A17073-50ul 50 ul
EUR 223.00

TUBB3 Rabbit pAb

A17074-100ul 100 ul
EUR 308.00

TUBB3 Rabbit pAb

A17074-200ul 200 ul
EUR 459.00

TUBB3 Rabbit pAb

A17074-20ul 20 ul
EUR 183.00

TUBB3 Rabbit pAb

A17074-50ul 50 ul
EUR 223.00

TUBB3 Mouse mAb

A18132-100ul 100 ul
EUR 384.00

TUBB3 Mouse mAb

A18132-200ul 200 ul
EUR 554.00

TUBB3 Mouse mAb

A18132-20ul 20 ul
EUR 183.00

TUBB3 Mouse mAb

A18132-50ul 50 ul
EUR 265.00

Anti-TUBB3 antibody

STJ113476 50 µl
EUR 287.00
Description: This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6.

Anti-TUBB3 antibody

STJ11100102 100 µl
EUR 393.00
Description: This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6.

Anti-TUBB3 antibody

STJ119330 100 µl
EUR 277.00

Anti-TUBB3 antibody

STJ119331 100 µl
EUR 277.00

Anti-TUBB3 antibody

STJ72867 100 µg
EUR 359.00

TUBB3 protein (His tag)

80R-2700 50 ug
EUR 424.00
Description: Purified recombinant TUBB3 protein (His tag)

Human TUBB3 ELISA Kit

ELA-E1638h 96 Tests
EUR 824.00

Human TUBB3 shRNA Plasmid

20-abx957032
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TUBB3 shRNA Plasmid

20-abx973259
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TUBB3 shRNA Plasmid

20-abx987934
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TUBB3 Monoclonal Conjugated Antibody

C30323 100ul
EUR 397.00

TUBB3 Antibody, HRP conjugated

1-CSB-PA03874B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TUBB3 Antibody, FITC conjugated

1-CSB-PA03874C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TUBB3 Antibody, Biotin conjugated

1-CSB-PA03874D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TUBB3 Antibody, HRP conjugated

1-CSB-PA03879B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TUBB3 Antibody, FITC conjugated

1-CSB-PA03879C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TUBB3 Antibody, Biotin conjugated

1-CSB-PA03879D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TUBB3 Recombinant Protein (Human)

RP033454 100 ug Ask for price

TUBB3 Recombinant Protein (Rat)

RP235280 100 ug Ask for price

TUBB3 Recombinant Protein (Mouse)

RP182243 100 ug Ask for price

anti- TUBB3 specific antibody

FNab09890 100µg
EUR 548.75
  • Recommended dilution: WB: 1:5000-1:50000
  • IHC: 1:50-1:500
  • Immunogen: AS160
  • Uniprot ID: Q13509
  • Gene ID: 10381
  • Research Area: Signal Transduction
Description: Antibody raised against TUBB3 specific

Tubulin Beta 3 (TUBB3) Antibody

20-abx242446
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

abx012294-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

abx019140-100ug 100 ug
EUR 342.00
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

abx019141-100ug 100 ug
EUR 342.00
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

abx032605-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

abx032605-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

abx036052-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

abx332407-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

TUBB3 Polyclonal Antibody, HRP Conjugated

A53966 100 µg
EUR 570.55
Description: The best epigenetics products

TUBB3 Polyclonal Antibody, FITC Conjugated

A53967 100 µg
EUR 570.55
Description: kits suitable for this type of research

TUBB3 Polyclonal Antibody, Biotin Conjugated

A53968 100 µg
EUR 570.55
Description: fast delivery possible

TUBB3 Polyclonal Antibody, HRP Conjugated

A51999 100 µg
EUR 570.55
Description: fast delivery possible

TUBB3 Polyclonal Antibody, FITC Conjugated

A52000 100 µg
EUR 570.55
Description: reagents widely cited

TUBB3 Polyclonal Antibody, Biotin Conjugated

A52001 100 µg
EUR 570.55
Description: Ask the seller for details

Tubulin Beta 3 (TUBB3) Antibody

20-abx002044
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBb3) Antibody

20-abx174960
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tubulin Beta 3 (TUBB3) Antibody

20-abx326995
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

20-abx326998
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

20-abx330237
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

abx331438-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

abx431689-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

beta III-Tubulin (TUBB3) Antibody

abx413644-01mg 0.1 mg
EUR 439.00
  • Shipped within 1 week.

Tubulin Beta 3 (TUBB3) Antibody

20-abx110304
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

20-abx110305
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin, Beta 3 (TUBB3) Antibody

20-abx116351
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

abx127119-50ul 50 ul
EUR 411.00
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

20-abx123449
  • EUR 592.00
  • EUR 857.00
  • EUR 217.00
  • EUR 411.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

20-abx121803
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

beta 3-Tubulin (TUBB3) Antibody

20-abx134677
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

20-abx134678
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

20-abx134679
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

20-abx134680
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

20-abx134681
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

beta 3-Tubulin (TUBB3) Antibody

20-abx134682
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody

20-abx134683
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

beta III-Tubulin (TUBB3) Antibody

abx139401-01mg 0.1 mg
EUR 411.00
  • Shipped within 5-12 working days.

Tubulin Beta 3 (TUBB3) Antibody

20-abx101413
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TUBB3 ORF Vector (Human) (pORF)

ORF011152 1.0 ug DNA
EUR 95.00

Tubb3 ORF Vector (Mouse) (pORF)

ORF060749 1.0 ug DNA
EUR 506.00

Tubb3 ORF Vector (Rat) (pORF)

ORF078428 1.0 ug DNA
EUR 506.00

Recombinant Tubulin Beta 3 (TUBb3)

4-RPE711Hu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13509
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 54.7kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Tubulin Beta 3 expressed in: E.coli

Polyclonal TUBB3 Antibody (N-term)

AMM05459G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TUBB3 (N-term). This antibody is tested and proven to work in the following applications:

Monoclonal TUBB3 Antibody, Clone: 2E9

APR13880G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human TUBB3. The antibodies are raised in Mouse and are from clone 2E9. This antibody is applicable in WB, FC, ICC, E

Tubulin Beta 3 (TUBb3) Antibody (FITC)

20-abx271228
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tubulin Beta 3 (TUBb3) Antibody (Biotin)

20-abx271494
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Tubulin Beta 3 (TUBB3) Protein

20-abx069520
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Tubulin beta-3 chain (TUBB3)

1-CSB-RP038744h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tubulin beta-3 chain(TUBB3),partial expressed in E.coli

Tubulin Beta 3 (TUBB3) Blocking Peptide

20-abx161513
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

beta III-Tubulin (TUBB3) Antibody (FITC)

abx413645-01mg 0.1 mg
EUR 648.00
  • Shipped within 1 week.

Tubulin Beta 3 (TUBB3) Antibody Pair

abx117637-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010.00
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (Biotin)

20-abx106017
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (Biotin)

20-abx106018
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (HRP)

20-abx108851
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (HRP)

20-abx108852
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (FITC)

20-abx107431
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (FITC)

20-abx107432
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubb3 sgRNA CRISPR Lentivector set (Mouse)

K4469301 3 x 1.0 ug
EUR 339.00

Tubb3 sgRNA CRISPR Lentivector set (Rat)

K6456501 3 x 1.0 ug
EUR 339.00

TUBB3 sgRNA CRISPR Lentivector set (Human)

K2558801 3 x 1.0 ug
EUR 339.00

Monoclonal TUBB3 / Tubulin Beta 3 Antibody

APR13875G 0.05ml
EUR 484.00
Description: A Monoclonal antibody against Human TUBB3 / Tubulin Beta 3. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P

Polyclonal TUBB3 / Tubulin Beta 3 Antibody

APR13876G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human TUBB3 / Tubulin Beta 3 . This antibody is tested and proven to work in the following applications:

Polyclonal TUBB3 / Tubulin Beta 3 Antibody

APR13877G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human TUBB3 / Tubulin Beta 3 . This antibody is tested and proven to work in the following applications:

Polyclonal TUBB3 antibody - C-terminal region

APR13882G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TUBB3 - C-terminal region. This antibody is tested and proven to work in the following applications:

Cow Tubulin Beta 3 (TUBB3) ELISA Kit

abx518029-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mouse Tubulin Beta 3 (TUBB3) ELISA Kit

abx518031-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Rat Tubulin Beta 3 (TUBB3) ELISA Kit

abx518032-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.