Successful Transition from Plasma Exchange to Eculizumab in Acetylcholine Receptor Antibody- and Muscle-Specific Kinase (MuSK) Antibody-Negative Myasthenia Gravis: A Case Report.

BACKGROUND The effectiveness of eculizumab (terminal complement inhibitor) at the acetylcholine receptor (AChR) antibody-negative general myasthenia gravis (GMG) is unknown. CASE REPORT A female patient was diagnosed with AChR-antibody and muscle-specific kinase (musk) antibody-negative GMG in March 2016. In January 2017, the patient was referred for plasma exchange (PLEX) because the symptoms continue.

He also received azathioprine, mycophenolate mofetil, and pyridostigmine (all continued during subsequent therapy). PLEX (5 sessions for 10 days) was initially effective, but over the next month PLEX patients received weekly, then twice a week, followed by 3 times a week for symptoms to worsen. In April 2018, PLEX reduced to two times a week following initiation of eculizumab (weekly induction dose of 900 mg 1 day after the first PLEX, plus 600 mg on day PLEX second session, for 4 weeks).

Patients then stabilized eculizumab 1200 mg every 2 weeks and PLEX treatment frequency reduced, until PLEX stopped on Sunday 39 after initiation of eculizumab. During eculizumab treatment, myasthenia gravis patients with activities of daily living (MG-ADL) scores decreased 9-1 or second most votes, with a temporary increase to 4 or 5 between Weeks 19 and 27 after eculizumab treatment less often. No side effects related to eculizumab.

CONCLUSION After the transition from three times a week PLEX for eculizumab in patients with treatment-refractory, AChR antibodies and antibody-negative musk GMG, there is clinically significant improvement in daily activities are affected by the symptoms of MG. Further investigation of eculizumab in antibody-negative MG necessary.

Human Tubulin Beta 3 (TUBb3) ELISA Kit
DL-TUBb3-Hu-192	DLdevelop	1 kit of 192 tests	EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 3 (TUBb3)

Human Tubulin Beta 3 (TUBb3) ELISA Kit
DL-TUBb3-Hu-48	DLdevelop	1 kit of 48 tests	EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 3 (TUBb3)

Human Tubulin Beta 3 (TUBb3) ELISA Kit
DL-TUBb3-Hu-96	DLdevelop	1 kit of 96 tests	EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 3 (TUBb3)

Human Tubulin Beta 3 (TUBb3) ELISA Kit
RD-TUBb3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521.00

Human Tubulin Beta 3 (TUBb3) ELISA Kit
RD-TUBb3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723.00

Human Tubulin Beta 3 (TUBb3) ELISA Kit
RDR-TUBb3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544.00

Human Tubulin Beta 3 (TUBb3) ELISA Kit
RDR-TUBb3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756.00

Tubb3/ Rat Tubb3 ELISA Kit
ELI-05371r	Lifescience Market	96 Tests	EUR 657.00

TUBB3 siRNA
20-abx905870	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBB3 antibody
10R-10559	Fitzgerald	100 ug	EUR 349.00
Description: Mouse monoclonal TUBB3 antibody

TUBB3 antibody
10R-8390	Fitzgerald	100 ul	EUR 392.00
Description: Mouse monoclonal TUBB3 antibody

TUBB3 antibody
10R-1824	Fitzgerald	100 ul	EUR 403.00
Description: Mouse monoclonal TUBB3 antibody

TUBB3 antibody
10R-6182	Fitzgerald	100 ul	EUR 726.00
Description: Mouse monoclonal TUBB3 antibody

TUBB3 Antibody
CSB-PA884597-	Cusabio		EUR 335.00
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

TUBB3 Antibody
CSB-PA884597-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

TUBB3 Antibody
1-CSB-PA917452	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:1000, IHC:1:25-1:50

TUBB3 Antibody
CSB-PA969690-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

TUBB3 Antibody
CSB-PA969690-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

TUBB3 Antibody
1-CSB-PA000385	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:2000-5000

TUBB3 Antibody
1-CSB-PA000393	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:2000-5000

TUBB3 siRNA
20-abx938564	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBB3 siRNA
20-abx938565	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBB3 Antibody
35539-100ul	SAB	100ul	EUR 252.00

TUBB3 antibody
70R-21061	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal TUBB3 antibody

TUBB3 antibody
70R-15421	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal TUBB3 antibody

TUBB3 Antibody
1-CSB-PA004349	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

TUBB3 Antibody
1-CSB-PA025323GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TUBB3 Antibody
1-CSB-PA03874A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

TUBB3 Antibody
1-CSB-PA03879A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

pOTB7-TUBB3
PVT18504	Lifescience Market	2 ug	EUR 231.00

TUBB3 Antibody
AF7000	Affbiotech	200ul	EUR 304.00
Description: TUBB3 Antibody detects endogenous levels of total TUBB3.

TUBB3 Antibody
BF0572	Affbiotech	200ul	EUR 376.00
Description: TUBB3 antibody detects endogenous levels of total TUBB3.

TUBB3 Polyclonal Antibody
A53965	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

TUBB3 Polyclonal Antibody
A51998	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

TUBB3 cloning plasmid
CSB-CL623813HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1353 Sequence: atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttctgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcggacttgcagctggagcggatcagcgtctactacaacgaggcctcttctcacaagt Show more
Description: A cloning plasmid for the TUBB3 gene.

TUBB3 Conjugated Antibody
C35539	SAB	100ul	EUR 397.00

TUBB3 Monoclonal Antibody
30323-100ul	SAB	100ul	EUR 252.00

TUBB3 Monoclonal Antibody
30323-50ul	SAB	50ul	EUR 187.00

TUBB3 antibody (HRP)
60R-2074	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal TUBB3 antibody (HRP)

TUBB3 antibody (FITC)
60R-2075	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal TUBB3 antibody (FITC)

TUBB3 antibody (biotin)
60R-2076	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal TUBB3 antibody (biotin)

anti-TUBB3 (2E9)
LF-MA30351	Abfrontier	100 ul	EUR 486.00
Description: Mouse Monoclonal to TUBB3

TUBB3 Blocking Peptide
BF0572-BP	Affbiotech	1mg	EUR 195.00

TUBB3 Blocking Peptide
AF7000-BP	Affbiotech	1mg	EUR 195.00

TUBB3 specific antibody
PAab09890	Lifescience Market	100 ug	EUR 386.00

TUBB3 Rabbit pAb
A17073-100ul	Abclonal	100 ul	EUR 308.00

TUBB3 Rabbit pAb
A17073-200ul	Abclonal	200 ul	EUR 459.00

TUBB3 Rabbit pAb
A17073-20ul	Abclonal	20 ul	EUR 183.00

TUBB3 Rabbit pAb
A17073-50ul	Abclonal	50 ul	EUR 223.00

TUBB3 Rabbit pAb
A17074-100ul	Abclonal	100 ul	EUR 308.00

TUBB3 Rabbit pAb
A17074-200ul	Abclonal	200 ul	EUR 459.00

TUBB3 Rabbit pAb
A17074-20ul	Abclonal	20 ul	EUR 183.00

TUBB3 Rabbit pAb
A17074-50ul	Abclonal	50 ul	EUR 223.00

TUBB3 Mouse mAb
A18132-100ul	Abclonal	100 ul	EUR 384.00

TUBB3 Mouse mAb
A18132-200ul	Abclonal	200 ul	EUR 554.00

TUBB3 Mouse mAb
A18132-20ul	Abclonal	20 ul	EUR 183.00

TUBB3 Mouse mAb
A18132-50ul	Abclonal	50 ul	EUR 265.00

Anti-TUBB3 antibody
STJ113476	St John's Laboratory	50 µl	EUR 287.00
Description: This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6.

Anti-TUBB3 antibody
STJ11100102	St John's Laboratory	100 µl	EUR 393.00
Description: This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6.

Anti-TUBB3 antibody
STJ119330	St John's Laboratory	100 µl	EUR 277.00

Anti-TUBB3 antibody
STJ119331	St John's Laboratory	100 µl	EUR 277.00

Anti-TUBB3 antibody
STJ72867	St John's Laboratory	100 µg	EUR 359.00

TUBB3 protein (His tag)
80R-2700	Fitzgerald	50 ug	EUR 424.00
Description: Purified recombinant TUBB3 protein (His tag)

Human TUBB3 ELISA Kit
ELA-E1638h	Lifescience Market	96 Tests	EUR 824.00

Human TUBB3 shRNA Plasmid
20-abx957032	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TUBB3 shRNA Plasmid
20-abx973259	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TUBB3 shRNA Plasmid
20-abx987934	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TUBB3 Monoclonal Conjugated Antibody
C30323	SAB	100ul	EUR 397.00

TUBB3 Antibody, HRP conjugated
1-CSB-PA03874B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TUBB3 Antibody, FITC conjugated
1-CSB-PA03874C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TUBB3 Antibody, Biotin conjugated
1-CSB-PA03874D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TUBB3 Antibody, HRP conjugated
1-CSB-PA03879B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TUBB3 Antibody, FITC conjugated
1-CSB-PA03879C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TUBB3 Antibody, Biotin conjugated
1-CSB-PA03879D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB3. Recognizes TUBB3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TUBB3 Recombinant Protein (Human)
RP033454	ABM	100 ug	Ask for price

TUBB3 Recombinant Protein (Rat)
RP235280	ABM	100 ug	Ask for price

TUBB3 Recombinant Protein (Mouse)
RP182243	ABM	100 ug	Ask for price

anti- TUBB3 specific antibody
FNab09890	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:5000-1:50000 IHC: 1:50-1:500 Immunogen: AS160 Uniprot ID: Q13509 Gene ID: 10381 Research Area: Signal Transduction
Description: Antibody raised against TUBB3 specific

Tubulin Beta 3 (TUBB3) Antibody
20-abx242446	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
abx012294-100ul	Abbexa	100 ul	EUR 411.00
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
abx019140-100ug	Abbexa	100 ug	EUR 342.00
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
abx019141-100ug	Abbexa	100 ug	EUR 342.00
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
abx032605-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
abx032605-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
abx036052-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
abx332407-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

TUBB3 Polyclonal Antibody, HRP Conjugated
A53966	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TUBB3 Polyclonal Antibody, FITC Conjugated
A53967	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

TUBB3 Polyclonal Antibody, Biotin Conjugated
A53968	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

TUBB3 Polyclonal Antibody, HRP Conjugated
A51999	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

TUBB3 Polyclonal Antibody, FITC Conjugated
A52000	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

TUBB3 Polyclonal Antibody, Biotin Conjugated
A52001	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Tubulin Beta 3 (TUBB3) Antibody
20-abx002044	Abbexa	EUR 411.00 EUR 592.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBb3) Antibody
20-abx174960	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Tubulin Beta 3 (TUBB3) Antibody
20-abx326995	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
20-abx326998	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
20-abx330237	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
abx331438-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
abx431689-200ul	Abbexa	200 ul	EUR 384.00
Shipped within 1-3 working days.

beta III-Tubulin (TUBB3) Antibody
abx413644-01mg	Abbexa	0.1 mg	EUR 439.00
Shipped within 1 week.

Tubulin Beta 3 (TUBB3) Antibody
20-abx110304	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
20-abx110305	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin, Beta 3 (TUBB3) Antibody
20-abx116351	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
abx127119-50ul	Abbexa	50 ul	EUR 411.00
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
20-abx123449	Abbexa	EUR 592.00 EUR 857.00 EUR 217.00 EUR 411.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
20-abx121803	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

beta 3-Tubulin (TUBB3) Antibody
20-abx134677	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
20-abx134678	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
20-abx134679	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
20-abx134680	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
20-abx134681	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

beta 3-Tubulin (TUBB3) Antibody
20-abx134682	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody
20-abx134683	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

beta III-Tubulin (TUBB3) Antibody
abx139401-01mg	Abbexa	0.1 mg	EUR 411.00
Shipped within 5-12 working days.

Tubulin Beta 3 (TUBB3) Antibody
20-abx101413	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

TUBB3 ORF Vector (Human) (pORF)
ORF011152	ABM	1.0 ug DNA	EUR 95.00

Tubb3 ORF Vector (Mouse) (pORF)
ORF060749	ABM	1.0 ug DNA	EUR 506.00

Tubb3 ORF Vector (Rat) (pORF)
ORF078428	ABM	1.0 ug DNA	EUR 506.00

Recombinant Tubulin Beta 3 (TUBb3)
4-RPE711Hu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q13509 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 54.7kDa Isoelectric Point: 6.1
Description: Recombinant Human Tubulin Beta 3 expressed in: E.coli

Polyclonal TUBB3 Antibody (N-term)
AMM05459G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TUBB3 (N-term). This antibody is tested and proven to work in the following applications:

Monoclonal TUBB3 Antibody, Clone: 2E9
APR13880G	Leading Biology	0.1ml	EUR 484.00
Description: A Monoclonal antibody against Human TUBB3. The antibodies are raised in Mouse and are from clone 2E9. This antibody is applicable in WB, FC, ICC, E

Tubulin Beta 3 (TUBb3) Antibody (FITC)
20-abx271228	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tubulin Beta 3 (TUBb3) Antibody (Biotin)
20-abx271494	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Tubulin Beta 3 (TUBB3) Protein
20-abx069520	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Tubulin beta-3 chain (TUBB3)
1-CSB-RP038744h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 50.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tubulin beta-3 chain(TUBB3),partial expressed in E.coli

Tubulin Beta 3 (TUBB3) Blocking Peptide
20-abx161513	Abbexa	EUR 606.00 EUR 1428.00	1 mg 5 mg
Shipped within 5-10 working days.

beta III-Tubulin (TUBB3) Antibody (FITC)
abx413645-01mg	Abbexa	0.1 mg	EUR 648.00
Shipped within 1 week.

Tubulin Beta 3 (TUBB3) Antibody Pair
abx117637-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010.00
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (Biotin)
20-abx106017	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (Biotin)
20-abx106018	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (HRP)
20-abx108851	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (HRP)
20-abx108852	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (FITC)
20-abx107431	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 3 (TUBB3) Antibody (FITC)
20-abx107432	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubb3 sgRNA CRISPR Lentivector set (Mouse)
K4469301	ABM	3 x 1.0 ug	EUR 339.00

Tubb3 sgRNA CRISPR Lentivector set (Rat)
K6456501	ABM	3 x 1.0 ug	EUR 339.00

TUBB3 sgRNA CRISPR Lentivector set (Human)
K2558801	ABM	3 x 1.0 ug	EUR 339.00

Monoclonal TUBB3 / Tubulin Beta 3 Antibody
APR13875G	Leading Biology	0.05ml	EUR 484.00
Description: A Monoclonal antibody against Human TUBB3 / Tubulin Beta 3. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P

Polyclonal TUBB3 / Tubulin Beta 3 Antibody
APR13876G	Leading Biology	0.05ml	EUR 484.00
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human TUBB3 / Tubulin Beta 3 . This antibody is tested and proven to work in the following applications:

Polyclonal TUBB3 / Tubulin Beta 3 Antibody
APR13877G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human TUBB3 / Tubulin Beta 3 . This antibody is tested and proven to work in the following applications:

Polyclonal TUBB3 antibody - C-terminal region
APR13882G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TUBB3 - C-terminal region. This antibody is tested and proven to work in the following applications:

Cow Tubulin Beta 3 (TUBB3) ELISA Kit
abx518029-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Mouse Tubulin Beta 3 (TUBB3) ELISA Kit
abx518031-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Rat Tubulin Beta 3 (TUBB3) ELISA Kit
abx518032-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.