Lab Reagents
Human IgG antibody Laboratories manufactures the rangap1 for troponin elisa test reagents distributed by Genprice. The Rangap1 For Troponin Elisa Test reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact troponin elisa. Other Rangap1 products are available in stock. Specificity: Rangap1 Category: For Group: Troponin Elisa
Troponin Elisa information
RANGAP1 antibody |
70R-19766 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RANGAP1 antibody |
RANGAP1 Antibody |
DF7315 |
Affbiotech |
200ul |
EUR 304 |
Description: RANGAP1 Antibody detects endogenous levels of total RANGAP1. |
RANGAP1 Antibody |
1-CSB-PA019318GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against RANGAP1. Recognizes RANGAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
anti-RANGAP1 |
YF-PA14295 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to RANGAP1 |
anti-RANGAP1 |
YF-PA14296 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to RANGAP1 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Polyclonal RANGAP1 Antibody |
APR02539G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RANGAP1 . This antibody is tested and proven to work in the following applications: |
RanGAP1 Conjugated Antibody |
C49918 |
SAB |
100ul |
EUR 397 |
RANGAP1 Conjugated Antibody |
C32818 |
SAB |
100ul |
EUR 397 |
RANGAP1 cloning plasmid |
CSB-CL019318HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1764
- Sequence: atggcctcggaagacattgccaagctggcagagacacttgccaagactcaggtggccgggggacagctgagtttcaaaggcaagagcctcaaactcaacactgcagaagatgctaaagatgtgattaaagagattgaagactttgacagcttggaggctctgcgtctggaaggca
- Show more
|
Description: A cloning plasmid for the RANGAP1 gene. |
RANGAP1 Rabbit pAb |
A5381-100ul |
Abclonal |
100 ul |
EUR 308 |
RANGAP1 Rabbit pAb |
A5381-200ul |
Abclonal |
200 ul |
EUR 459 |
RANGAP1 Rabbit pAb |
A5381-20ul |
Abclonal |
20 ul |
EUR 183 |
RANGAP1 Rabbit pAb |
A5381-50ul |
Abclonal |
50 ul |
EUR 223 |
RANGAP1 Rabbit pAb |
A13347-100ul |
Abclonal |
100 ul |
EUR 308 |
RANGAP1 Rabbit pAb |
A13347-200ul |
Abclonal |
200 ul |
EUR 459 |