Rangap1 For Troponin Elisa Test

Lab Reagents

Human IgG antibody Laboratories manufactures the rangap1 for troponin elisa test reagents distributed by Genprice. The Rangap1 For Troponin Elisa Test reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact troponin elisa. Other Rangap1 products are available in stock. Specificity: Rangap1 Category: For Group: Troponin Elisa

Troponin Elisa information

RANGAP1 siRNA

20-abx930862
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RANGAP1 siRNA

20-abx930863
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RANGAP1 Antibody

ABD7315 100 ug
EUR 438

anti-RANGAP1

YF-PA14295 50 ul
EUR 363
Description: Mouse polyclonal to RANGAP1

anti-RANGAP1

YF-PA14296 50 ug
EUR 363
Description: Mouse polyclonal to RANGAP1

RANGAP1 ELISA KIT|Human

EF002309 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

RANGAP1 Rabbit pAb

A13347-100ul 100 ul
EUR 308

RANGAP1 Rabbit pAb

A13347-200ul 200 ul
EUR 459

RANGAP1 Rabbit pAb

A13347-20ul 20 ul
EUR 183

RANGAP1 Rabbit pAb

A13347-50ul 50 ul
EUR 223

RanGAP1 Blocking Peptide

33R-5742 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RANGAP1 antibody, catalog no. 70R-5479

Polyclonal RANGAP1 Antibody

APR02539G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RANGAP1 . This antibody is tested and proven to work in the following applications:

RANGAP1 Blocking Peptide

DF7315-BP 1mg
EUR 195

RanGAP1 Conjugated Antibody

C49918 100ul
EUR 397

RANGAP1 Conjugated Antibody

C32818 100ul
EUR 397

RANGAP1 cloning plasmid

CSB-CL019318HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1764
  • Sequence: atggcctcggaagacattgccaagctggcagagacacttgccaagactcaggtggccgggggacagctgagtttcaaaggcaagagcctcaaactcaacactgcagaagatgctaaagatgtgattaaagagattgaagactttgacagcttggaggctctgcgtctggaaggca
  • Show more
Description: A cloning plasmid for the RANGAP1 gene.