Lab Reagents
Human IgG antibody Laboratories manufactures the rangap1 for troponin elisa test reagents distributed by Genprice. The Rangap1 For Troponin Elisa Test reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact troponin elisa. Other Rangap1 products are available in stock. Specificity: Rangap1 Category: For Group: Troponin Elisa
Troponin Elisa information
RANGAP1 siRNA |
|
20-abx930862 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RANGAP1 siRNA |
|
20-abx930863 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RANGAP1 |
|
YF-PA14295 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to RANGAP1 |
anti-RANGAP1 |
|
YF-PA14296 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to RANGAP1 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
RANGAP1 Rabbit pAb |
|
A13347-100ul |
Abclonal |
100 ul |
EUR 308 |
RANGAP1 Rabbit pAb |
|
A13347-200ul |
Abclonal |
200 ul |
EUR 459 |
RANGAP1 Rabbit pAb |
|
A13347-20ul |
Abclonal |
20 ul |
EUR 183 |
RANGAP1 Rabbit pAb |
|
A13347-50ul |
Abclonal |
50 ul |
EUR 223 |
RanGAP1 Blocking Peptide |
|
33R-5742 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RANGAP1 antibody, catalog no. 70R-5479 |
Polyclonal RANGAP1 Antibody |
|
APR02539G |
Leading Biology |
0.05ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RANGAP1 . This antibody is tested and proven to work in the following applications: |
RANGAP1 Blocking Peptide |
|
DF7315-BP |
Affbiotech |
1mg |
EUR 195 |
RanGAP1 Conjugated Antibody |
|
C49918 |
SAB |
100ul |
EUR 397 |
RANGAP1 Conjugated Antibody |
|
C32818 |
SAB |
100ul |
EUR 397 |
RANGAP1 cloning plasmid |
|
CSB-CL019318HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1764
- Sequence: atggcctcggaagacattgccaagctggcagagacacttgccaagactcaggtggccgggggacagctgagtttcaaaggcaagagcctcaaactcaacactgcagaagatgctaaagatgtgattaaagagattgaagactttgacagcttggaggctctgcgtctggaaggca
- Show more
|
|
Description: A cloning plasmid for the RANGAP1 gene. |
