Left diaphragmatic hernia following thoracoabdominal aortic repair: A case report.

diaphragmatic hernia is a rather rare complication of thoracoabdominal interventions. Given the end of the clinical manifestations and misdiagnosis, their incidence is unknown. These hernias have a high risk of death when emergency intervention is justified because of the complications of visceral strangulation.

We present case 67 years old male with a history of thoracoabdominal aortic repair, which reconsults for upper gastrointestinal bleeding. Upon arrival, imaging shows herniation left diaphragm with the migration of the stomach, omentum and spleen into the chest cavity. Through a laparoscopic approach, left diaphragmatic hernia defect identified by the protrusion of half the stomach, omentum and the posterior aspect of the spleen with sub capsular tear. In addition, the syndrome of severe adhesion to the chest wall and diaphragm are also evident, with entrapment of the inferior lobe of the left lung.

The contents were reduced, but the lung decortication and extensive adhesiolisis through thoracoscopy is required for complete extraction, allowing primary repair without tension.We present rare pathology without incident founded, which has implications relevant clinical and surgical treatment of each level, in this case requires interdisciplinary management. Suspicion diaphragmatic hernia in patients with a medical history of thoracoabdominal aortic repair with non-specific gastrointestinal symptoms is important. We emphasize the importance of clinical suspicion of this complication after surgery precedent has been identified.

Silicone oils have been used for many years in retinal surgery for retinal detachment. One of the complications reported were oil migration into the periorbital region, so granulomatous reaction.

A woman of 56 years, with a history of retinal detachment repaired by vitrectomy, silicone oil removal and epi-retinal membrane peeling, presented to us by unilateral ptosis and skin lesions that resemble xanthelasma.Histopathology silicone oil is infiltrating the lesion showed the surrounding connective tissue and fat in the absence of foaming histiocytes.

We reported cases of migration of silicone oil with a pseudo-xanthelasma lesions. It has been reported only twice to the best of our knowledge in English literature was written.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
DLR-TUBb1-Mu-48T	DL Develop	48T	EUR 527.00
Should the Mouse Tubulin Beta 1 (TUBb1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Beta 1 (TUBb1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
DLR-TUBb1-Mu-96T	DL Develop	96T	EUR 688.00
Should the Mouse Tubulin Beta 1 (TUBb1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Beta 1 (TUBb1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tubulin Beta 1 (TUBb1) ELISA Kit
DL-TUBb1-Hu-192	DLdevelop	1 kit of 192 tests	EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 1 (TUBb1)

Human Tubulin Beta 1 (TUBb1) ELISA Kit
DL-TUBb1-Hu-48	DLdevelop	1 kit of 48 tests	EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 1 (TUBb1)

Human Tubulin Beta 1 (TUBb1) ELISA Kit
DL-TUBb1-Hu-96	DLdevelop	1 kit of 96 tests	EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 1 (TUBb1)

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
DL-TUBb1-Mu-192	DLdevelop	1 kit of 192 tests	EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tubulin Beta 1 (TUBb1)

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
DL-TUBb1-Mu-48	DLdevelop	1 kit of 48 tests	EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tubulin Beta 1 (TUBb1)

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
DL-TUBb1-Mu-96	DLdevelop	1 kit of 96 tests	EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tubulin Beta 1 (TUBb1)

Human Tubulin Beta 1 (TUBb1) ELISA Kit
RD-TUBb1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521.00

Human Tubulin Beta 1 (TUBb1) ELISA Kit
RD-TUBb1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723.00

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
RD-TUBb1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533.00

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
RD-TUBb1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740.00

Human Tubulin Beta 1 (TUBb1) ELISA Kit
RDR-TUBb1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544.00

Human Tubulin Beta 1 (TUBb1) ELISA Kit
RDR-TUBb1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756.00

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
RDR-TUBb1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557.00

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
RDR-TUBb1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774.00

TUBB1 antibody
10R-1659	Fitzgerald	100 ug	EUR 512.00
Description: Mouse monoclonal TUBB1 antibody

TUBB1 antibody
22114-100ul	SAB	100ul	EUR 390.00

TUBB1 Antibody
1-CSB-PA867148LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

TUBB1 siRNA
20-abx938558	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBB1 siRNA
20-abx938559	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-TUBB1
YF-PA21123	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to TUBB1

anti-TUBB1
YF-PA21124	Abfrontier	100 ul	EUR 403.00
Description: Rabbit polyclonal to TUBB1

anti-TUBB1
YF-PA21125	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to TUBB1

TUBB1 Polyclonal Antibody
A67370	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

TUBB1 cloning plasmid
CSB-CL867148HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1356 Sequence: atgcgtgaaattgtccatattcagattggccagtgtggcaaccagatcggagccaagttctgggagatgattggtgaggaacacgggatcgacttggctgggagcgaccgcggggcctcggccttgcagctggagagaatcagcgtgtactacaacgaagcctacggtaggaaat Show more
Description: A cloning plasmid for the TUBB1 gene.

TUBB1 Polyclonal Antibody
30175-100ul	SAB	100ul	EUR 252.00

TUBB1 Polyclonal Antibody
30175-50ul	SAB	50ul	EUR 187.00

TUBB1 Rabbit pAb
A17779-100ul	Abclonal	100 ul	EUR 308.00

TUBB1 Rabbit pAb
A17779-200ul	Abclonal	200 ul	EUR 459.00

TUBB1 Rabbit pAb
A17779-20ul	Abclonal	20 ul	EUR 183.00

TUBB1 Rabbit pAb
A17779-50ul	Abclonal	50 ul	EUR 223.00

Anti-TUBB1 antibody
STJ119814	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010]

TUBB1 Antibody, HRP conjugated
1-CSB-PA867148LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TUBB1 Antibody, FITC conjugated
1-CSB-PA867148LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TUBB1 Antibody, Biotin conjugated
1-CSB-PA867148LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human TUBB1 shRNA Plasmid
20-abx962942	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TUBB1 shRNA Plasmid
20-abx984119	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TUBB1 Polyclonal Conjugated Antibody
C30175	SAB	100ul	EUR 397.00

TUBB1 Recombinant Protein (Human)
RP033439	ABM	100 ug	Ask for price

TUBB1 Recombinant Protein (Mouse)
RP182234	ABM	100 ug	Ask for price

Tubulin Beta 1 (TUBb1) Antibody
20-abx178748	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Tubulin Beta 1 (TUBB1) Antibody
abx224141-100ug	Abbexa	100 ug	EUR 411.00
Shipped within 5-10 working days.

beta I Tubulin (TUBB1) Antibody
20-abx219168	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody
20-abx005943	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody
20-abx318661	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TUBB1 Polyclonal Antibody, HRP Conjugated
A67371	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

TUBB1 Polyclonal Antibody, FITC Conjugated
A67372	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

TUBB1 Polyclonal Antibody, Biotin Conjugated
A67373	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Tubulin Beta 1 (TUBB1) Antibody
20-abx129118	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tubulin Beta 1 (TUBB1) Antibody
abx145776-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

beta 1-Tubulin (TUBB1) Antibody
20-abx134686	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

beta 1-Tubulin (TUBB1) Antibody
20-abx134687	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody
20-abx110582	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody
20-abx101412	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

TUBB1 ORF Vector (Human) (pORF)
ORF011147	ABM	1.0 ug DNA	EUR 95.00

Tubb1 ORF Vector (Mouse) (pORF)
ORF060746	ABM	1.0 ug DNA	EUR 506.00

Recombinant Tubulin Beta 1 (TUBb1)
4-RPE707Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9H4B7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Tubulin Beta 1 expressed in: E.coli

Recombinant Tubulin Beta 1 (TUBb1)
4-RPE707Mu01	Cloud-Clone	EUR 521.12 EUR 242.00 EUR 1679.20 EUR 626.40 EUR 1152.80 EUR 412.00 EUR 4048.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: A2AQ07 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.9kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Tubulin Beta 1 expressed in: E.coli

Monoclonal TUBB1 Antibody, Clone: 2A1A9
AMM08378G	Leading Biology	0.1ml	EUR 528.00
Description: A Monoclonal antibody against Human TUBB1. The antibodies are raised in Mouse and are from clone 2A1A9. This antibody is applicable in WB and IHC, FC, ICC, E

Mouse Tubulin Beta 1 (TUBB1) Protein
20-abx069519	Abbexa	EUR 732.00 EUR 286.00 EUR 2263.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tubulin Beta 1 (TUBB1) Antibody (HRP)
20-abx310961	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody (FITC)
20-abx310962	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody (Biotin)
20-abx310963	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 1 (TUBb1) Antibody Pair
20-abx370772	Abbexa	EUR 1664.00 EUR 1066.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Tubulin Beta 1 (TUBB1) Antibody (Biotin)
20-abx106312	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody (HRP)
20-abx109143	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody (FITC)
20-abx107725	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Tubulin Beta 1 (TUBB1) Protein
20-abx166510	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tubb1 sgRNA CRISPR Lentivector set (Mouse)
K3248801	ABM	3 x 1.0 ug	EUR 339.00

TUBB1 sgRNA CRISPR Lentivector set (Human)
K2558401	ABM	3 x 1.0 ug	EUR 339.00

Tubulin Beta 1 Class VI (TUBB1) Antibody
20-abx159741	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 1 Class VI (TUBB1) Antibody
20-abx159742	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Tubulin Beta 1 Class VI (TUBB1) Antibody
abx159743-100ul	Abbexa	100 ul	EUR 356.00
Shipped within 5-10 working days.

Tubulin Beta 1 Class VI (TUBB1) Antibody
abx159744-100ul	Abbexa	100 ul	EUR 356.00
Shipped within 5-10 working days.

Mouse Tubulin Beta 1 (TUBB1) ELISA Kit
20-abx154820	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tubulin Beta 1 (TUBB1) CLIA Kit
20-abx496423	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Tubulin Beta 1 (TUBB1) CLIA Kit
20-abx494707	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Tubulin Beta 1 (TUBB1) ELISA Kit
20-abx585021	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Tubb1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3248802	ABM	1.0 ug DNA	EUR 154.00

Tubb1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3248803	ABM	1.0 ug DNA	EUR 154.00

Tubb1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3248804	ABM	1.0 ug DNA	EUR 154.00

TUBB1 Protein Vector (Human) (pPB-C-His)
PV044585	ABM	500 ng	EUR 329.00

TUBB1 Protein Vector (Human) (pPB-N-His)
PV044586	ABM	500 ng	EUR 329.00

TUBB1 Protein Vector (Human) (pPM-C-HA)
PV044587	ABM	500 ng	EUR 329.00

TUBB1 Protein Vector (Human) (pPM-C-His)
PV044588	ABM	500 ng	EUR 329.00

TUBB1 Protein Vector (Mouse) (pPB-C-His)
PV242982	ABM	500 ng	EUR 603.00

TUBB1 Protein Vector (Mouse) (pPB-N-His)
PV242983	ABM	500 ng	EUR 603.00

TUBB1 Protein Vector (Mouse) (pPM-C-HA)
PV242984	ABM	500 ng	EUR 603.00

TUBB1 Protein Vector (Mouse) (pPM-C-His)
PV242985	ABM	500 ng	EUR 603.00

TUBB1 3'UTR Luciferase Stable Cell Line
TU027517	ABM	1.0 ml	EUR 1521.00

TUBB1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2558402	ABM	1.0 ug DNA	EUR 154.00

TUBB1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2558403	ABM	1.0 ug DNA	EUR 154.00

TUBB1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2558404	ABM	1.0 ug DNA	EUR 154.00

Human Tubulin Beta 1 (TUBb1) ELISA Kit
SEE707Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.50
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Beta 1 (TUBb1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tubulin Beta 1 (TUBb1) ELISA Kit
SEE707Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.30
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Beta 1 (TUBb1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tubulin Beta 1 (TUBb1) ELISA Kit
SEE707Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639.00
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Beta 1 (TUBb1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tubulin Beta 1 (TUBb1) ELISA Kit
SEE707Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.50
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Beta 1 (TUBb1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tubulin Beta 1 (TUBb1) ELISA Kit
4-SEE707Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tubulin Beta 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tubulin Beta 1 (TUBb1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
SEE707Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.40
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Beta 1 (TUBb1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
SEE707Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Beta 1 (TUBb1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
SEE707Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.40
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Beta 1 (TUBb1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
SEE707Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.80
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Beta 1 (TUBb1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
4-SEE707Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tubulin Beta 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Tubulin Beta 1 (TUBb1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Tubb1 3'UTR GFP Stable Cell Line
TU171357	ABM	1.0 ml	Ask for price

TUBB1 3'UTR GFP Stable Cell Line
TU077517	ABM	1.0 ml	EUR 1521.00

Tubb1 3'UTR Luciferase Stable Cell Line
TU121357	ABM	1.0 ml	Ask for price

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse)
4-PAE707Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Pro182~Glu437) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1)

Human Tubulin Beta 1 ELISA Kit (TUBb1)
RK02465	Abclonal	96 Tests	EUR 521.00

Human Tubulin Beta 1(TUBb1)ELISA Kit
QY-E01100	Qayee Biotechnology	96T	EUR 361.00

Human tubulin, beta 1 (TUBB1) Control/blocking peptide
AB-23096-P	Alpha Diagnostics	100ug	EUR 164.00

Mouse Tubulin beta- 1 chain, Tubb1 ELISA KIT
ELI-41547m	Lifescience Market	96 Tests	EUR 865.00

Human Tubulin beta- 1 chain, TUBB1 ELISA KIT
ELI-41927h	Lifescience Market	96 Tests	EUR 824.00

ELISA kit for Human TUBb1 (Tubulin Beta 1)
ELK5509	ELK Biotech	1 plate of 96 wells	EUR 432.00
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tubulin Beta 1 (TUB?1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tubulin Bet Show more
Description: A sandwich ELISA kit for detection of Tubulin Beta 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse TUBb1 (Tubulin Beta 1)
ELK6324	ELK Biotech	1 plate of 96 wells	EUR 432.00
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tubulin Beta 1 (TUB?1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tubulin Bet Show more
Description: A sandwich ELISA kit for detection of Tubulin Beta 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Tubulin beta-1 chain(TUBB1) ELISA kit
CSB-EL025319HU-24T	Cusabio	1 plate of 24 wells	EUR 165.00
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tubulin beta-1 chain (TUBB1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tubulin beta-1 chain(TUBB1) ELISA kit
1-CSB-EL025319HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tubulin beta-1 chain(TUBB1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig)
4-PAE707Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Ser166~His451) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1)

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), APC
4-PAE707Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Pro182~Glu437) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with APC.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), Biotinylated
4-PAE707Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Pro182~Glu437) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with Biotin.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), Cy3
4-PAE707Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Pro182~Glu437) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with Cy3.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), FITC
4-PAE707Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Pro182~Glu437) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with FITC.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), HRP
4-PAE707Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Pro182~Glu437) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with HRP.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), PE
4-PAE707Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Pro182~Glu437) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with PE.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), APC
4-PAE707Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Ser166~His451) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with APC.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAE707Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Ser166~His451) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with Biotin.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), Cy3
4-PAE707Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Ser166~His451) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with Cy3.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), FITC
4-PAE707Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Ser166~His451) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with FITC.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), HRP
4-PAE707Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Ser166~His451) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with HRP.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), PE
4-PAE707Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Ser166~His451) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with PE.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAE707Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Pro182~Glu437) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with APC-Cy7.

Rabbit Anti-Human tubulin, beta 1 (TUBB1) IgG (aff pure)
AB-23096-A	Alpha Diagnostics	100ug	EUR 482.00

Tubb1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3248805	ABM	3 x 1.0 ug	EUR 376.00

TUBB1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2558405	ABM	3 x 1.0 ug	EUR 376.00

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAE707Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TUBb1 (Ser166~His451) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with APC-Cy7.

Tubb1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3248806	ABM	1.0 ug DNA	EUR 167.00

Tubb1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3248807	ABM	1.0 ug DNA	EUR 167.00

Tubb1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3248808	ABM	1.0 ug DNA	EUR 167.00

TUBB1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2558406	ABM	1.0 ug DNA	EUR 167.00

TUBB1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2558407	ABM	1.0 ug DNA	EUR 167.00

TUBB1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2558408	ABM	1.0 ug DNA	EUR 167.00