Left diaphragmatic hernia following thoracoabdominal aortic repair: A case report.

diaphragmatic hernia is a rather rare complication of thoracoabdominal interventions. Given the end of the clinical manifestations and misdiagnosis, their incidence is unknown. These hernias have a high risk of death when emergency intervention is justified because of the complications of visceral strangulation.

We present case 67 years old male with a history of thoracoabdominal aortic repair, which reconsults for upper gastrointestinal bleeding. Upon arrival, imaging shows herniation left diaphragm with the migration of the stomach, omentum and spleen into the chest cavity. Through a laparoscopic approach, left diaphragmatic hernia defect identified by the protrusion of half the stomach, omentum and the posterior aspect of the spleen with sub capsular tear. In addition, the syndrome of severe adhesion to the chest wall and diaphragm are also evident, with entrapment of the inferior lobe of the left lung.

The contents were reduced, but the lung decortication and extensive adhesiolisis through thoracoscopy is required for complete extraction, allowing primary repair without tension.We present rare pathology without incident founded, which has implications relevant clinical and surgical treatment of each level, in this case requires interdisciplinary management. Suspicion diaphragmatic hernia in patients with a medical history of thoracoabdominal aortic repair with non-specific gastrointestinal symptoms is important. We emphasize the importance of clinical suspicion of this complication after surgery precedent has been identified.

Silicone oils have been used for many years in retinal surgery for retinal detachment. One of the complications reported were oil migration into the periorbital region, so granulomatous reaction.

A woman of 56 years, with a history of retinal detachment repaired by vitrectomy, silicone oil removal and epi-retinal membrane peeling, presented to us by unilateral ptosis and skin lesions that resemble xanthelasma.Histopathology silicone oil is infiltrating the lesion showed the surrounding connective tissue and fat in the absence of foaming histiocytes.

We reported cases of migration of silicone oil with a pseudo-xanthelasma lesions. It has been reported only twice to the best of our knowledge in English literature was written.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

DLR-TUBb1-Mu-48T 48T
EUR 527.00
  • Should the Mouse Tubulin Beta 1 (TUBb1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Beta 1 (TUBb1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

DLR-TUBb1-Mu-96T 96T
EUR 688.00
  • Should the Mouse Tubulin Beta 1 (TUBb1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Beta 1 (TUBb1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tubulin Beta 1 (TUBb1) ELISA Kit

DL-TUBb1-Hu-192 1 kit of 192 tests
EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 1 (TUBb1)

Human Tubulin Beta 1 (TUBb1) ELISA Kit

DL-TUBb1-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 1 (TUBb1)

Human Tubulin Beta 1 (TUBb1) ELISA Kit

DL-TUBb1-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Beta 1 (TUBb1)

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

DL-TUBb1-Mu-192 1 kit of 192 tests
EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tubulin Beta 1 (TUBb1)

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

DL-TUBb1-Mu-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tubulin Beta 1 (TUBb1)

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

DL-TUBb1-Mu-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tubulin Beta 1 (TUBb1)

Human Tubulin Beta 1 (TUBb1) ELISA Kit

RD-TUBb1-Hu-48Tests 48 Tests
EUR 521.00

Human Tubulin Beta 1 (TUBb1) ELISA Kit

RD-TUBb1-Hu-96Tests 96 Tests
EUR 723.00

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

RD-TUBb1-Mu-48Tests 48 Tests
EUR 533.00

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

RD-TUBb1-Mu-96Tests 96 Tests
EUR 740.00

Human Tubulin Beta 1 (TUBb1) ELISA Kit

RDR-TUBb1-Hu-48Tests 48 Tests
EUR 544.00

Human Tubulin Beta 1 (TUBb1) ELISA Kit

RDR-TUBb1-Hu-96Tests 96 Tests
EUR 756.00

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

RDR-TUBb1-Mu-48Tests 48 Tests
EUR 557.00

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

RDR-TUBb1-Mu-96Tests 96 Tests
EUR 774.00

TUBB1 antibody

10R-1659 100 ug
EUR 512.00
Description: Mouse monoclonal TUBB1 antibody

TUBB1 antibody

22114-100ul 100ul
EUR 390.00

TUBB1 Antibody

1-CSB-PA867148LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

TUBB1 siRNA

20-abx938558
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TUBB1 siRNA

20-abx938559
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TUBB1

YF-PA21123 50 ug
EUR 363.00
Description: Mouse polyclonal to TUBB1

anti-TUBB1

YF-PA21124 100 ul
EUR 403.00
Description: Rabbit polyclonal to TUBB1

anti-TUBB1

YF-PA21125 100 ug
EUR 403.00
Description: Rabbit polyclonal to TUBB1

TUBB1 Polyclonal Antibody

A67370 100 µg
EUR 570.55
Description: kits suitable for this type of research

TUBB1 cloning plasmid

CSB-CL867148HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1356
  • Sequence: atgcgtgaaattgtccatattcagattggccagtgtggcaaccagatcggagccaagttctgggagatgattggtgaggaacacgggatcgacttggctgggagcgaccgcggggcctcggccttgcagctggagagaatcagcgtgtactacaacgaagcctacggtaggaaat
  • Show more
Description: A cloning plasmid for the TUBB1 gene.

TUBB1 Polyclonal Antibody

30175-100ul 100ul
EUR 252.00

TUBB1 Polyclonal Antibody

30175-50ul 50ul
EUR 187.00

TUBB1 Rabbit pAb

A17779-100ul 100 ul
EUR 308.00

TUBB1 Rabbit pAb

A17779-200ul 200 ul
EUR 459.00

TUBB1 Rabbit pAb

A17779-20ul 20 ul
EUR 183.00

TUBB1 Rabbit pAb

A17779-50ul 50 ul
EUR 223.00

Anti-TUBB1 antibody

STJ119814 100 µl
EUR 277.00
Description: This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010]

TUBB1 Antibody, HRP conjugated

1-CSB-PA867148LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TUBB1 Antibody, FITC conjugated

1-CSB-PA867148LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TUBB1 Antibody, Biotin conjugated

1-CSB-PA867148LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human TUBB1 shRNA Plasmid

20-abx962942
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TUBB1 shRNA Plasmid

20-abx984119
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TUBB1 Polyclonal Conjugated Antibody

C30175 100ul
EUR 397.00

TUBB1 Recombinant Protein (Human)

RP033439 100 ug Ask for price

TUBB1 Recombinant Protein (Mouse)

RP182234 100 ug Ask for price

Tubulin Beta 1 (TUBb1) Antibody

20-abx178748
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tubulin Beta 1 (TUBB1) Antibody

abx224141-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.

beta I Tubulin (TUBB1) Antibody

20-abx219168
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody

20-abx005943
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody

20-abx318661
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TUBB1 Polyclonal Antibody, HRP Conjugated

A67371 100 µg
EUR 570.55
Description: fast delivery possible

TUBB1 Polyclonal Antibody, FITC Conjugated

A67372 100 µg
EUR 570.55
Description: reagents widely cited

TUBB1 Polyclonal Antibody, Biotin Conjugated

A67373 100 µg
EUR 570.55
Description: Ask the seller for details

Tubulin Beta 1 (TUBB1) Antibody

20-abx129118
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tubulin Beta 1 (TUBB1) Antibody

abx145776-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

beta 1-Tubulin (TUBB1) Antibody

20-abx134686
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

beta 1-Tubulin (TUBB1) Antibody

20-abx134687
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody

20-abx110582
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody

20-abx101412
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TUBB1 ORF Vector (Human) (pORF)

ORF011147 1.0 ug DNA
EUR 95.00

Tubb1 ORF Vector (Mouse) (pORF)

ORF060746 1.0 ug DNA
EUR 506.00

Recombinant Tubulin Beta 1 (TUBb1)

4-RPE707Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H4B7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Tubulin Beta 1 expressed in: E.coli

Recombinant Tubulin Beta 1 (TUBb1)

4-RPE707Mu01
  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: A2AQ07
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Tubulin Beta 1 expressed in: E.coli

Monoclonal TUBB1 Antibody, Clone: 2A1A9

AMM08378G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human TUBB1. The antibodies are raised in Mouse and are from clone 2A1A9. This antibody is applicable in WB and IHC, FC, ICC, E

Mouse Tubulin Beta 1 (TUBB1) Protein

20-abx069519
  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tubulin Beta 1 (TUBB1) Antibody (HRP)

20-abx310961
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody (FITC)

20-abx310962
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody (Biotin)

20-abx310963
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 1 (TUBb1) Antibody Pair

20-abx370772
  • EUR 1664.00
  • EUR 1066.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Tubulin Beta 1 (TUBB1) Antibody (Biotin)

20-abx106312
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody (HRP)

20-abx109143
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 1 (TUBB1) Antibody (FITC)

20-abx107725
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Tubulin Beta 1 (TUBB1) Protein

20-abx166510
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tubb1 sgRNA CRISPR Lentivector set (Mouse)

K3248801 3 x 1.0 ug
EUR 339.00

TUBB1 sgRNA CRISPR Lentivector set (Human)

K2558401 3 x 1.0 ug
EUR 339.00

Tubulin Beta 1 Class VI (TUBB1) Antibody

20-abx159741
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 1 Class VI (TUBB1) Antibody

20-abx159742
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tubulin Beta 1 Class VI (TUBB1) Antibody

abx159743-100ul 100 ul
EUR 356.00
  • Shipped within 5-10 working days.

Tubulin Beta 1 Class VI (TUBB1) Antibody

abx159744-100ul 100 ul
EUR 356.00
  • Shipped within 5-10 working days.

Mouse Tubulin Beta 1 (TUBB1) ELISA Kit

20-abx154820
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tubulin Beta 1 (TUBB1) CLIA Kit

20-abx496423
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Tubulin Beta 1 (TUBB1) CLIA Kit

20-abx494707
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Tubulin Beta 1 (TUBB1) ELISA Kit

20-abx585021
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Tubb1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3248802 1.0 ug DNA
EUR 154.00

Tubb1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3248803 1.0 ug DNA
EUR 154.00

Tubb1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3248804 1.0 ug DNA
EUR 154.00

TUBB1 Protein Vector (Human) (pPB-C-His)

PV044585 500 ng
EUR 329.00

TUBB1 Protein Vector (Human) (pPB-N-His)

PV044586 500 ng
EUR 329.00

TUBB1 Protein Vector (Human) (pPM-C-HA)

PV044587 500 ng
EUR 329.00

TUBB1 Protein Vector (Human) (pPM-C-His)

PV044588 500 ng
EUR 329.00

TUBB1 Protein Vector (Mouse) (pPB-C-His)

PV242982 500 ng
EUR 603.00

TUBB1 Protein Vector (Mouse) (pPB-N-His)

PV242983 500 ng
EUR 603.00

TUBB1 Protein Vector (Mouse) (pPM-C-HA)

PV242984 500 ng
EUR 603.00

TUBB1 Protein Vector (Mouse) (pPM-C-His)

PV242985 500 ng
EUR 603.00

TUBB1 3'UTR Luciferase Stable Cell Line

TU027517 1.0 ml
EUR 1521.00

TUBB1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2558402 1.0 ug DNA
EUR 154.00

TUBB1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2558403 1.0 ug DNA
EUR 154.00

TUBB1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2558404 1.0 ug DNA
EUR 154.00

Human Tubulin Beta 1 (TUBb1) ELISA Kit

SEE707Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Beta 1 (TUBb1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tubulin Beta 1 (TUBb1) ELISA Kit

SEE707Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.30
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Beta 1 (TUBb1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tubulin Beta 1 (TUBb1) ELISA Kit

SEE707Hu-1x96wellstestplate 1x96-wells test plate
EUR 639.00
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Beta 1 (TUBb1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tubulin Beta 1 (TUBb1) ELISA Kit

SEE707Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tubulin Beta 1 (TUBb1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tubulin Beta 1 (TUBb1) ELISA Kit

4-SEE707Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tubulin Beta 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tubulin Beta 1 (TUBb1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

SEE707Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.40
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Beta 1 (TUBb1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

SEE707Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Beta 1 (TUBb1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

SEE707Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.40
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Beta 1 (TUBb1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

SEE707Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.80
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Tubulin Beta 1 (TUBb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Tubulin Beta 1 (TUBb1) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Tubulin Beta 1 (TUBb1) ELISA Kit

4-SEE707Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tubulin Beta 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Tubulin Beta 1 (TUBb1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Tubb1 3'UTR GFP Stable Cell Line

TU171357 1.0 ml Ask for price

TUBB1 3'UTR GFP Stable Cell Line

TU077517 1.0 ml
EUR 1521.00

Tubb1 3'UTR Luciferase Stable Cell Line

TU121357 1.0 ml Ask for price

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse)

4-PAE707Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Pro182~Glu437)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1)

Human Tubulin Beta 1 ELISA Kit (TUBb1)

RK02465 96 Tests
EUR 521.00

Human Tubulin Beta 1(TUBb1)ELISA Kit

QY-E01100 96T
EUR 361.00

Human tubulin, beta 1 (TUBB1) Control/blocking peptide

AB-23096-P 100ug
EUR 164.00

Mouse Tubulin beta- 1 chain, Tubb1 ELISA KIT

ELI-41547m 96 Tests
EUR 865.00

Human Tubulin beta- 1 chain, TUBB1 ELISA KIT

ELI-41927h 96 Tests
EUR 824.00

ELISA kit for Human TUBb1 (Tubulin Beta 1)

ELK5509 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tubulin Beta 1 (TUB?1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tubulin Bet
  • Show more
Description: A sandwich ELISA kit for detection of Tubulin Beta 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse TUBb1 (Tubulin Beta 1)

ELK6324 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tubulin Beta 1 (TUB?1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tubulin Bet
  • Show more
Description: A sandwich ELISA kit for detection of Tubulin Beta 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Tubulin beta-1 chain(TUBB1) ELISA kit

CSB-EL025319HU-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tubulin beta-1 chain (TUBB1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tubulin beta-1 chain(TUBB1) ELISA kit

1-CSB-EL025319HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tubulin beta-1 chain(TUBB1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig)

4-PAE707Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Ser166~His451)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1)

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), APC

4-PAE707Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Pro182~Glu437)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with APC.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), Biotinylated

4-PAE707Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Pro182~Glu437)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with Biotin.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), Cy3

4-PAE707Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Pro182~Glu437)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with Cy3.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), FITC

4-PAE707Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Pro182~Glu437)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with FITC.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), HRP

4-PAE707Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Pro182~Glu437)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with HRP.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), PE

4-PAE707Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Pro182~Glu437)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with PE.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), APC

4-PAE707Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Ser166~His451)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with APC.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), Biotinylated

4-PAE707Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Ser166~His451)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with Biotin.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), Cy3

4-PAE707Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Ser166~His451)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with Cy3.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), FITC

4-PAE707Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Ser166~His451)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with FITC.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), HRP

4-PAE707Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Ser166~His451)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with HRP.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), PE

4-PAE707Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Ser166~His451)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with PE.

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAE707Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Pro182~Glu437)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tubulin Beta 1 (TUBb1). This antibody is labeled with APC-Cy7.

Rabbit Anti-Human tubulin, beta 1 (TUBB1) IgG (aff pure)

AB-23096-A 100ug
EUR 482.00

Tubb1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3248805 3 x 1.0 ug
EUR 376.00

TUBB1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2558405 3 x 1.0 ug
EUR 376.00

Tubulin Beta 1 (TUBb1) Polyclonal Antibody (Human, Pig), APC-Cy7

4-PAE707Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TUBb1 (Ser166~His451)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Tubulin Beta 1 (TUBb1). This antibody is labeled with APC-Cy7.

Tubb1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3248806 1.0 ug DNA
EUR 167.00

Tubb1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3248807 1.0 ug DNA
EUR 167.00

Tubb1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3248808 1.0 ug DNA
EUR 167.00

TUBB1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2558406 1.0 ug DNA
EUR 167.00

TUBB1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2558407 1.0 ug DNA
EUR 167.00

TUBB1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2558408 1.0 ug DNA
EUR 167.00