Congenital arrhinia: A case report and literature review.

Underdevelopment wide nose entities spectrum ranges from the absence of some of the nose to the default arrhinia (CA). CA is a congenital absence of the external nose, nasal cavity, and / or ± nose nostrils olfactory apparatus, and is a very rare entity is less than 50 cases reported in the literature.

CA can be isolated and idiopathic origin or be part of a certain genetic syndromes associated. Of note, isolated CA can be inherited as an autosomal dominant condition with a complete report of a female patient penetrance.We Palestinian 13-month-old with isolated CA complicated with recurrent lower tract infections and upper respiratory (ARI).

Family history was significant for mothers with underdevelopment incomplete and complicated than the external nose and nostrils of the nose. Patients using a tracheostomy to breathe and wait for the optimal age for surgical correction. In addition, we reviewed the available literature using PubMed and summarized all cases reported 2016-2019 CA since two studies have been presented literature before 2016, and presented them in a very comprehensive table.CA mostly idiopathic and not well understood.

Although the CA can be inherited and run in families with incomplete penetrance, there is no cause genetic abnormalities have been found in most of the cases were reported. CA frequently presents with upper airway obstruction and respiratory distress, recurrent lower and URTI, and difficulty eating. CA managed initially with a tracheostomy and should be followed by surgical correction at the appropriate age.

CA can be sporadic, family, or part of a syndrome. CA brings morbidity and mortality and tracheostomy should be included at the outset to reduce the CA of complications early and followed by reconstruction surgery when the patient reaches the age of preschool / school. More studies are needed to determine CA heritage.

TUBB2B antibody

70R-21060 50 ul
EUR 435.00
Description: Rabbit polyclonal TUBB2B antibody

TUBB2B siRNA

20-abx938562
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TUBB2B siRNA

20-abx938563
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TUBB2B siRNA

20-abx905869
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TUBB2B Antibody

1-CSB-PA025321GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TUBB2B. Recognizes TUBB2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

pOTB7-TUBB2B

PVT18477 2 ug
EUR 231.00

TUBB2B cloning plasmid

CSB-CL866291HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1338
  • Sequence: atgcgtgagatcgtgcacatccaggcgggccagtgcggcaaccagatcggcgccaagttttgggaggtcatcagtgatgagcatgggattgaccccactggcagttaccatggagacagtgatttgcagctggagagaatcaatgtttactacaatgaagccactggtaacaaat
  • Show more
Description: A cloning plasmid for the TUBB2B gene.

Mouse TUBB2B shRNA Plasmid

20-abx978007
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TUBB2B shRNA Plasmid

20-abx988485
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TUBB2B shRNA Plasmid

20-abx967514
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TUBB2B Recombinant Protein (Mouse)

RP182240 100 ug Ask for price

TUBB2B Recombinant Protein (Rat)

RP235277 100 ug Ask for price

TUBB2B Recombinant Protein (Human)

RP033448 100 ug Ask for price

Tubulin Beta 2B (TUBB2B) Antibody

abx026514-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Tubulin Beta 2B (TUBB2B) Antibody

abx026514-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Tubulin Beta 2B (TUBB2B) Antibody

20-abx137361
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Tubulin, Beta 2B (TUBB2B) Antibody

20-abx116350
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tubulin Beta 2B (TUBB2B) Antibody

abx145775-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Tubb2b ORF Vector (Rat) (pORF)

ORF078427 1.0 ug DNA
EUR 506.00

TUBB2B ORF Vector (Human) (pORF)

ORF011150 1.0 ug DNA
EUR 95.00

Tubb2b ORF Vector (Mouse) (pORF)

ORF060748 1.0 ug DNA
EUR 506.00

Polyclonal TUBB2B Antibody (N-term)

AMM08383G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TUBB2B (N-term). This antibody is tested and proven to work in the following applications:

TUBB2B sgRNA CRISPR Lentivector set (Human)

K2558601 3 x 1.0 ug
EUR 339.00

Tubb2b sgRNA CRISPR Lentivector set (Mouse)

K3533201 3 x 1.0 ug
EUR 339.00

Tubb2b sgRNA CRISPR Lentivector set (Rat)

K7326701 3 x 1.0 ug
EUR 339.00

TUBB2B sgRNA CRISPR Lentivector (Human) (Target 1)

K2558602 1.0 ug DNA
EUR 154.00

TUBB2B sgRNA CRISPR Lentivector (Human) (Target 2)

K2558603 1.0 ug DNA
EUR 154.00

TUBB2B sgRNA CRISPR Lentivector (Human) (Target 3)

K2558604 1.0 ug DNA
EUR 154.00

Tubb2b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3533202 1.0 ug DNA
EUR 154.00

Tubb2b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3533203 1.0 ug DNA
EUR 154.00

Tubb2b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3533204 1.0 ug DNA
EUR 154.00

TUBB2B Protein Vector (Mouse) (pPB-C-His)

PV242990 500 ng
EUR 603.00

TUBB2B Protein Vector (Mouse) (pPB-N-His)

PV242991 500 ng
EUR 603.00

TUBB2B Protein Vector (Mouse) (pPM-C-HA)

PV242992 500 ng
EUR 603.00

TUBB2B Protein Vector (Mouse) (pPM-C-His)

PV242993 500 ng
EUR 603.00

Tubb2b sgRNA CRISPR Lentivector (Rat) (Target 1)

K7326702 1.0 ug DNA
EUR 154.00

Tubb2b sgRNA CRISPR Lentivector (Rat) (Target 2)

K7326703 1.0 ug DNA
EUR 154.00

Tubb2b sgRNA CRISPR Lentivector (Rat) (Target 3)

K7326704 1.0 ug DNA
EUR 154.00

TUBB2B Protein Vector (Human) (pPB-C-His)

PV044597 500 ng
EUR 329.00

TUBB2B Protein Vector (Human) (pPB-N-His)

PV044598 500 ng
EUR 329.00

TUBB2B Protein Vector (Human) (pPM-C-HA)

PV044599 500 ng
EUR 329.00

TUBB2B Protein Vector (Human) (pPM-C-His)

PV044600 500 ng
EUR 329.00

Tubb2b 3'UTR GFP Stable Cell Line

TU171359 1.0 ml Ask for price

TUBB2B Protein Vector (Rat) (pPB-C-His)

PV313706 500 ng
EUR 603.00

TUBB2B Protein Vector (Rat) (pPB-N-His)

PV313707 500 ng
EUR 603.00

TUBB2B Protein Vector (Rat) (pPM-C-HA)

PV313708 500 ng
EUR 603.00

TUBB2B Protein Vector (Rat) (pPM-C-His)

PV313709 500 ng
EUR 603.00

TUBB2B 3'UTR Luciferase Stable Cell Line

TU027521 1.0 ml
EUR 1394.00

TUBB2B 3'UTR GFP Stable Cell Line

TU077521 1.0 ml
EUR 1394.00

Tubb2b 3'UTR Luciferase Stable Cell Line

TU121359 1.0 ml Ask for price

Monoclonal TUBB2B Antibody (clone AT5B3), Clone: AT5B3

AMM08382G 0.05ml
EUR 484.00
Description: A Monoclonal antibody against Human TUBB2B (clone AT5B3). The antibodies are raised in Mouse and are from clone AT5B3. This antibody is applicable in IHC-P

Tubb2b 3'UTR Luciferase Stable Cell Line

TU222655 1.0 ml Ask for price

Tubb2b 3'UTR GFP Stable Cell Line

TU272655 1.0 ml Ask for price

Bovine Tubulin beta- 2B chain, TUBB2B ELISA KIT

ELI-18808b 96 Tests
EUR 928.00

Mouse Tubulin beta- 2B chain, Tubb2b ELISA KIT

ELI-52874m 96 Tests
EUR 865.00

Human Tubulin beta- 2B chain, TUBB2B ELISA KIT

ELI-53135h 96 Tests
EUR 824.00

TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662527 1.0 ug DNA
EUR 682.00

TUBB2B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662531 1.0 ug DNA
EUR 682.00

TUBB2B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662532 1.0 ug DNA
EUR 682.00

TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2558605 3 x 1.0 ug
EUR 376.00

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3533205 3 x 1.0 ug
EUR 376.00

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7326705 3 x 1.0 ug
EUR 376.00

TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2558606 1.0 ug DNA
EUR 167.00

TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2558607 1.0 ug DNA
EUR 167.00

TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2558608 1.0 ug DNA
EUR 167.00

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3533206 1.0 ug DNA
EUR 167.00

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3533207 1.0 ug DNA
EUR 167.00

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3533208 1.0 ug DNA
EUR 167.00

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7326706 1.0 ug DNA
EUR 167.00

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7326707 1.0 ug DNA
EUR 167.00

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7326708 1.0 ug DNA
EUR 167.00

TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV662528 1.0 ug DNA
EUR 682.00

TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV662529 1.0 ug DNA
EUR 740.00

TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV662530 1.0 ug DNA
EUR 740.00