Can Uou Trust Sars 2 Anyibody Test

Lab Reagents

Human IgG antibody Laboratories manufactures the can uou trust sars 2 anyibody test reagents distributed by Genprice. The Can Uou Trust Sars 2 Anyibody Test reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Antibody. Other Can products are available in stock. Specificity: Can Category: Uou Group: Trust Sars

Trust Sars information

Human Calcineurin (CaN) ELISA Kit

RDR-CaN-Hu-96Tests 96 Tests
EUR 724

Mouse Calcineurin (CaN) ELISA Kit

RDR-CaN-Mu-48Tests 48 Tests
EUR 534

Mouse Calcineurin (CaN) ELISA Kit

RDR-CaN-Mu-96Tests 96 Tests
EUR 742

Rat Calcineurin (CaN) ELISA Kit

RDR-CaN-Ra-48Tests 48 Tests
EUR 558

Rat Calcineurin (CaN) ELISA Kit

RDR-CaN-Ra-96Tests 96 Tests
EUR 776

Human Calcineurin (CaN) ELISA Kit

RD-CaN-Hu-48Tests 48 Tests
EUR 500

Human Calcineurin (CaN) ELISA Kit

RD-CaN-Hu-96Tests 96 Tests
EUR 692

Mouse Calcineurin (CaN) ELISA Kit

RD-CaN-Mu-48Tests 48 Tests
EUR 511

Mouse Calcineurin (CaN) ELISA Kit

RD-CaN-Mu-96Tests 96 Tests
EUR 709

Rat Calcineurin (CaN) ELISA Kit

RD-CaN-Ra-48Tests 48 Tests
EUR 534

Rat Calcineurin (CaN) ELISA Kit

RD-CaN-Ra-96Tests 96 Tests
EUR 742

LH (Luteinizing Hormone) ELISA test

2 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of LH (Luteinizing Hormone)

Shikari (Q-CAN) Canakinumab (Ilaris)Free drug ELISA kit

CAN-FD-ILA 1x96-wells test plate
EUR 878
Description: Enzyme Immunoassay for detection of freeCanakinumab (Ilaris) in human serum and plasma samples.

NATtrol Zika Virus Stock (Qualitative) (1 mL)

TEST 1 mL
EUR 1106.64
  • What is the product classification?
  • NATtrol Zika Virus Stock Qualitative is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

TRUST ELISA KIT|Human

EF007321 96 Tests
EUR 689

anti- SARS antibody

FNab07609 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: seryl-tRNA synthetase
  • Uniprot ID: P49591
  • Gene ID: 6301
  • Research Area: Metabolism
Description: Antibody raised against SARS

Human CaN(Calcineurin) ELISA Kit

EH2757 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P35658
  • Alias: CaN
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse CaN(Calcineurin) ELISA Kit

EM0896 96T
EUR 524.1
  • Detection range: 19.531-1250 pg/ml
  • Alias: CaN
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 11.719pg/ml

CaN/ Rat CaN ELISA Kit

ELA-E1323r 96 Tests
EUR 886

Dog Minor allergen Can f 2

1-CSB-EP521201DO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Dog Minor allergen Can f 2 expressed in E.coli

Sars/ Rat Sars ELISA Kit

ELI-41050r 96 Tests
EUR 886

Calcineurin (CaN) Antibody

20-abx175647
  • EUR 1247.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Calcineurin (CaN) Antibody

20-abx100441
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcineurin (CaN) Antibody

20-abx171508
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Calcineurin (CaN) Antibody

20-abx171509
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Calcineurin (CaN)

4-RPB323Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q08209
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.4kDa
  • Isoelectric Point: 6.5
Description: Recombinant Human Calcineurin expressed in: E.coli

Anti-SARS-CoV-2 Antibody

A2061-50 50 µg
EUR 480

SARS CoV-2 PCR kit

PCR-H731-48R 48T
EUR 823

SARS CoV-2 PCR kit

PCR-H731-96R 96T
EUR 1113

SARS antibody

70R-20086 50 ul
EUR 435
Description: Rabbit polyclonal SARS antibody

SARS antibody

70R-1444 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody

70R-1445 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody

39139-100ul 100ul
EUR 252

SARS Antibody

1-CSB-PA04145A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody

1-CSB-PA020709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA

20-abx904776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS

PVT12269 2 ug
EUR 391

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Can F 1 protein

30R-3057 100 ug
EUR 412
Description: Purified recombinant Can F 1 protein

Can F 1 protein

30R-3058 500 ug
EUR 1559
Description: Purified recombinant Can F 1 protein

Can F 1 protein

30R-3059 1 mg
EUR 2518
Description: Purified recombinant Can F 1 protein

Human Calcineurin (CaN) Protein

20-abx065654
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human CaN ELISA Kit

EHC0542 96Tests
EUR 521

Goat CaN ELISA Kit

EGTC0542 96Tests
EUR 521

Bovine CaN ELISA Kit

EBC0542 96Tests
EUR 521

Canine CaN ELISA Kit

ECC0542 96Tests
EUR 521

Chicken CaN ELISA Kit

ECKC0542 96Tests
EUR 521

Anserini CaN ELISA Kit

EAC0542 96Tests
EUR 521

CaN ELISA KIT|Human

EF006666 96 Tests
EUR 689

Calcineurin (CaN) Antibody Pair

20-abx370540
  • EUR 1790.00
  • EUR 1149.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Rat Calcineurin (CaN) Protein

20-abx652731
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse CaN ELISA Kit

EMC0542 96Tests
EUR 521

Rat CaN ELISA Kit

ERC0542 96Tests
EUR 521

Sheep CaN ELISA Kit

ESC0542 96Tests
EUR 521

Rabbit CaN ELISA Kit

ERTC0542 96Tests
EUR 521

Monkey CaN ELISA Kit

EMKC0542 96Tests
EUR 521

Porcine CaN ELISA Kit

EPC0542 96Tests
EUR 521

Can f 1, Dog

LF-P0506 0.1 mg
EUR 350
Description: Can f 1, Dog protein

Can f 1, Dog

LF-P0506A 0.5 mg
EUR 1247
Description: Can f 1, Dog protein

Can f 1, Dog

LF-P0506B 1 mg
EUR 1998
Description: Can f 1, Dog protein

SARS-CoV-2 Antigen ELISA Kit

DEIA2020 96 tests
EUR 905
  • The LOD of this kit is 1 ng/mL of SARS-COV-2 nucleoprotein.
Description: SARS-CoV-2 Antigen ELISA Kit intended use is for quantitative detection of the recombinant SARS-COV-2 nucleoprotein antigen in human serum. The use of this kit for natural samples need to be validated by the end user due to the complexity of natural targets and unpredictable interference.

SARS-CoV-2 IgG ELISA Kit

E4901-100 100 assays
EUR 753

Recombinant Coronavirus Nucleoprotein (SARS-CoV-2)

P1523-10 10 µg
EUR 156

Recombinant Coronavirus Nucleoprotein (SARS-CoV-2)

P1523-50 50 µg
EUR 551

SARS CoV-2 RT PCR kit

RTq-H731-100R 100T
EUR 1311

SARS CoV-2 RT PCR kit

RTq-H731-150R 150T
EUR 1787

SARS CoV-2 RT PCR kit

RTq-H731-50R 50T
EUR 963

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug 500ug
EUR 663

SARS Spike Antibody

24216-100ul 100ul
EUR 390

SARS Spike Antibody

24217-100ul 100ul
EUR 390

SARS Spike Antibody

24218-100ul 100ul
EUR 390

SARS Spike Antibody

24219-100ul 100ul
EUR 390

SARS Spike Antibody

24318-100ul 100ul
EUR 390

SARS Matrix Antibody

24319-100ul 100ul
EUR 390

SARS Matrix Antibody

24320-100ul 100ul
EUR 390

SARS Envelope Antibody

24321-100ul 100ul
EUR 390

SARS Envelope Antibody

24322-100ul 100ul
EUR 390

SARS Rabbit pAb

A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb

A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb

A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb

A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide

33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide

33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody

10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody

10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]

DAG1861 500 ug
EUR 2529

SARS S2 [His]

DAG1862 500 ug
EUR 2529

SARS-E2 Antibody

abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody

C39139 100ul
EUR 397

SARS cloning plasmid

CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb

A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb

A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb

A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb

A6733-50ul 50 ul
EUR 223

SARS Polyclonal Antibody

A53977 100 µg
EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate

H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody

PAab07609 100 ug
EUR 386

Anti-SARS antibody

STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)

YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS

DNASE TEST AGAR

D04-101-10kg 10 kg Ask for price

DNASE TEST AGAR

D04-101-2Kg 2 Kg Ask for price

DNASE TEST AGAR

D04-101-500g 500 g Ask for price

DERMATOPHYTE TEST AGAR

D04-107-10kg 10 kg
EUR 849

DERMATOPHYTE TEST AGAR

D04-107-2Kg 2 Kg
EUR 224

DERMATOPHYTE TEST AGAR

D04-107-500g 500 g
EUR 97

MOTILITY TEST MEDIUM

M13-121-10kg 10 kg
EUR 1528

MOTILITY TEST MEDIUM

M13-121-2Kg 2 Kg
EUR 371

MOTILITY TEST MEDIUM

M13-121-500g 500 g
EUR 137

SNYDER TEST AGAR

S19-119-10kg 10 kg
EUR 1049

SNYDER TEST AGAR

S19-119-2Kg 2 Kg
EUR 267

SNYDER TEST AGAR

S19-119-500g 500 g
EUR 109

SAM Test Strip

TS00201s-30 30 tests
EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip

TS00301s-30 30 tests
EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip

TS00401s-30 30 tests
EUR 553
Description: Serum homocysteine quantitative test strip

Sars sgRNA CRISPR Lentivector (Rat) (Target 2)

K7368703 1.0 ug DNA
EUR 154

Sars sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3355203 1.0 ug DNA
EUR 154

SARS sgRNA CRISPR Lentivector (Human) (Target 2)

K2089803 1.0 ug DNA
EUR 154

Coronavirus (SARS-CoV-2) PCR Detection Kit

K1460 100 Rxns
EUR 570
  • The kit includes: Non-Template Negative Control (NTC), COVID-19 Positive control (PTC), PCR Primer/ Probe set, 2X qPCR Master Mix, Rehydration Buffer and Reverse Transcription Mix
Description: Kit for detection of SARS-CoV-2 in respiratory specimens using Real-Time (RT-PCR).

Anti-SARS-CoV-2 Antibody (Clone# 6F10)

A2060-50 50 µg
EUR 480

Anti-SARS-CoV-2 Spike S1 Antibody

A3000-50 50 µg
EUR 419

Recombinant SARS-CoV-2 Nucleoprotein (1-430)

P1537-10 10 µg
EUR 156

Recombinant SARS-CoV-2 Nucleoprotein (1-430)

P1537-50 50 µg
EUR 530

Recombinant SARS-CoV-2 Nucleoprotein (1-430)

P1539-10 10 µg
EUR 156

Recombinant SARS-CoV-2 Nucleoprotein (1-430)

P1539-50 50 µg
EUR 530

Recombinant SARS-CoV-2 3C-like Proteinase

P1550-10 10 μg
EUR 156

Recombinant SARS-CoV-2 3C-like Proteinase

P1550-50 50 μg
EUR 551

Recombinant SARS-CoV-2 Papain-like Protease

P1551-10 10 μg
EUR 156

Recombinant SARS-CoV-2 Papain-like Protease

P1551-50 50 μg
EUR 551

Coronavirus (SARS-CoV-2) PCR Detection Kit

K1460-100 100 Rxns Ask for price

SARS CoV-2 One-Step PCR kit

Oneq-H731-100R 100T
EUR 1610

SARS CoV-2 One-Step PCR kit

Oneq-H731-150R 150T
EUR 2205

SARS CoV-2 One-Step PCR kit

Oneq-H731-50R 50T
EUR 1175

Human calcineurin,CaN ELISA Kit

201-12-1478 96 tests
EUR 440
  • This calcineurin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Calcineurin (CaN) CLIA Kit

abx196494-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Calcineurin (CaN) CLIA Kit

abx196765-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Calcineurin (CAN) CLIA Kit

abx196766-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Calcineurin (CaN) ELISA Kit

20-abx156923
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Calcineurin (CaN) ELISA Kit

20-abx155289
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Calcineurin (CaN) ELISA Kit

20-abx150899
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Calcineurin (CaN) ELISA Kit

abx255236-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Rat Calcineurin (CaN) ELISA Kit

abx256768-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Calcineurin (CaN) ELISA Kit

abx252135-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Guinea Pig CaN ELISA Kit

EGC0542 96Tests
EUR 521

Human calcineurin,CaN ELISA Kit

CN-03976H1 96T
EUR 447

Human calcineurin,CaN ELISA Kit

CN-03976H2 48T
EUR 296

Chicken Calcineurin (CaN) ELISA Kit

abx354684-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Calcineurin (CaN) ELISA Kit

abx354949-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Calcineurin (CaN) ELISA Kit

abx355104-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Calcineurin (CaN) ELISA Kit

abx355256-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Calcineurin (CaN) ELISA Kit

abx355360-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Human Calcineurin (CaN) CLIA Kit

20-abx492639
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Calcineurin (CaN) CLIA Kit

20-abx492640
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Calcineurin (CaN) CLIA Kit

20-abx492641
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human calcineurin(CaN)ELISA Kit

GA-E1494HM-48T 48T
EUR 289

Human calcineurin(CaN)ELISA Kit

GA-E1494HM-96T 96T
EUR 466

Mouse Calcineurin(CaN)ELISA kit

GA-E0776MS-48T 48T
EUR 336

Mouse Calcineurin(CaN)ELISA kit

GA-E0776MS-96T 96T
EUR 534

Rat calcineurin(CaN)ELISA Kit

GA-E0247RT-48T 48T
EUR 373